• Users Online: 191
  • Print this page
  • Email this page


 
 
Table of Contents
BASIC RESEARCH
Year : 2018  |  Volume : 8  |  Issue : 8  |  Page : 387-393

Effect of crocin carotenoid on BDNF and CREB gene expression in brain ventral tegmental area of morphine treated rats


1 Department of Clinical Biochemistry, Faculty of Medicine, Rafsanjan University of Medical Sciences, Rafsanjan, Iran
2 Department of Clinical Biochemistry, Afzalipoor Faculty of Medicine, Kerman University of Medical Sciences, Kerman; Department of Clinical Biochemistry, Faculty of Medicine; Molecular Medicine Research Center, Research Institute of Basic Medical Sciences, Rafsanjan University of Medical Sciences, Rafsanjan, Iran
3 Physiology-Pharmacology Research Center, Research Institute of Basic Medical Sciences, Rafsanjan University of Medical Sciences; Department of Physiology and Pharmacology, School of Medicine, Rafsanjan University of Medical Sciences, Rafsanjan, Iran, India
4 Molecular Medicine Research Center, Research Institute of Basic Medical Sciences, Rafsanjan University of Medical Sciences, Rafsanjan, Iran
5 Department of Clinical Biochemistry, Faculty of Medicine, and Pistachio Safety Research Center, Rafsanjan University of Medical Sciences, Rafsanjan, Iran
6 Department of Clinical Biochemistry, Faculty of Medicine; Molecular Medicine Research Center, Research Institute of Basic Medical Sciences, Rafsanjan University of Medical Sciences, Rafsanjan, Iran

Date of Submission30-May-2018
Date of Decision21-Jun-2018
Date of Acceptance30-Jul-2018
Date of Web Publication23-Aug-2018

Correspondence Address:
Mohammad Reza Hajizadeh
Molecular Medicine Research Center, Rafsanjan University of Medical Sciences, Rafsanjan
Iran
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/2221-1691.239426

Get Permissions

  Abstract 


Objective: To investigate the effect of crocin carotenoid on BNDF and CREB gene expression in the brain ventral tegmental area (VTA) and the serum level of BDNF in morphine-treated rats compared to control. Methods: In this study, 40 male Wistar rats (200-250 g) were used in 5 experimental groups: 1) non morphine treat rats (control); 2) non morphine-treated rats with 25 mg/kg crocin carotenoid (i.p., for 21 d); 3) morphine treated rats (10 mg/kg twice a day, s.c., 21 d); 4 and 5) morphine-treated rats with 12.5 and 25 mg/kg crocin carotenoid, respectively. By the end of research, BDNF and CREB expression was determined by real-time-PCR method. ELISA analysis was also applied for assessing the serum BDNF level. Results: The data indicated that morphine treatment could cause a significant decrease in BDNF and CREB gene expression (P<0.01 and P<0.001, respectively) in brain VTA as well as serum level of BDNF (P<0.01) in comparison to control group. Treatment with 25 mg/kg crocin carotenoid caused a significant enhancement in BDNF and CREF gene expression (P<0.01 and P<0.05, respectively) and serum level of BDNF (P<0.01) in morphine-treated rats in comparison to morphine-treated group. Conclusions: Regarding to obtained results, crocin carotenoid can inhibit unfavorable effects of morphine on the neural system to some extent through enhancing BDNF and CREB gene expression in brain VTA and serum level of BDNF.

Keywords: Morphine, BDNF, CREB,Crocin, Ventral tegmental area Rat


How to cite this article:
Rezai M, Mahmoodi M, Kaeidi A, Karimabad MN, Khoshdel A, Hajizadeh MR. Effect of crocin carotenoid on BDNF and CREB gene expression in brain ventral tegmental area of morphine treated rats. Asian Pac J Trop Biomed 2018;8:387-93

How to cite this URL:
Rezai M, Mahmoodi M, Kaeidi A, Karimabad MN, Khoshdel A, Hajizadeh MR. Effect of crocin carotenoid on BDNF and CREB gene expression in brain ventral tegmental area of morphine treated rats. Asian Pac J Trop Biomed [serial online] 2018 [cited 2018 Nov 12];8:387-93. Available from: http://www.apjtb.org/text.asp?2018/8/8/387/239426

Foundation project: This project was financially supported by a grant from the Rafsanjan University of Medical Sciences (20/341/1395)





  1. Introduction Top


Morphine is a very important drug, which is a powerful painkiller[1]. Opiate dependence is caused by long-term consumption of these materials[2]. It has been illustrated that chronic use of opioid drugs could cause long-term changes in brain[3]. Regarding to the definition of American Society of Addiction Medicine Association, addiction is a chronic disease, making procedures such as joy, reward, memory and incentives in brain[4]. The μ-opioid receptor of opiates is positioned in some areas of brain regulating feeling of pain like gray cortex, thalamus and cortex and the ventral tegmental area (VTA) and nucleus accumbens (NAc) regulating understanding of the joy and rewarding. Therefore, they could describe the reason of analgesic properties and joyful and euphoric properties created by opiates[5]. Dopaminergic neurons originated from the VTA area of neurons are sent to NAc and could be affected by rewards such as natural rewards like eating, sexual issues and several medicines. Under such conditions, controlling the GABAergic interneurons in the VTA area is removed from the dopaminergic neurons and causes neural to shoot an increased level of extracellular dopamine in the NAc and as a result, punishment process is started[6]. The main neurotrophin brain-derived neurotrophic factor (BDNF) is the main neurotrophin in the brain, which could activate intracellular signaling through binding to its receptors, which is essential to neuronal survival, neuronal differentiation and regulation of learning and memory[7]. Moreover, BDNF plays a role in transcription and translation of proteins involved in several steps of synapse development and is also an underlying factor in the pathology of neural disease like Alzheimer’s disease, schizophrenia and depression[8]. In opioid-depended individual, the serum level of BDNF is decreased[9]. Furthermore, in morphine-depended situation, BDNF gene exon is transcribed in low level. In these individuals, BDNF gene expression in the VTA is reduced[0]. Cyclic AMP response element binding protein (CREB) is a central protein distributed in the whole body and its particular molecular mass is in average equal to 46 kDa. CREB is recognized as one of the transcription factors[11]. CREB helps control of cell growth steps such as proliferation, differentiation, survival and neural formation, learning and memory[12]. CREB regulated the expression of genes like BDNF and plays a key role in the mediation of response of neurotrophin[13]. As BDNF gene expression is regulated by CREB, decreased level of CREB could reduce BDNF level and hence, it might lead to damage of neural system due to the function of neurotrophins in the brain. Saffron contains numerous compounds such as α -protein (a water-soluble carotenoid), crocins (including crocin, dicrocin, tricrosin, picrocrocin)[14]. It has been shown that saffron or its compounds (such as crocin) have various pharmacological properties such as antioxidant and neuroprotection[15]. Saffron could decrease sedimentation and accumulation of beta-amyloid in the brain[16]. Additionally, it has been shown that crocin has learning and memory space increase properties[17]. The moment it was mentioned, BDNF is an underlying factor for neural growth and CREF could regulate the gene transcription and may play a key role in important processes such as neural survival and regulation of cognitive processes such as memory space and learning. Consequently, decrease of BDNF and CREB gene expression could pave the way for neural disorders such as depressive disorder and Alzheimer. The main objective of this research was to investigate the effect of crocin carotenoid on BDNF and CREB gene expression in the brain VTA area and serum level of BDNF in morphine treat rats.


  2. Materials and methods Top


2.1. Animals

In this study, 40 male Wistar rats of (200-250 g) were used. The rats were retained in separate cages and in the animal house of Rafsanjan University of Medical Sciences under the temperature of 22-24 °C and the 12-hour dark lighting period. During the study time, food and water were provided for them freely. Working with animals was done based on the approval of the Ethics Committee of Rafsanjan University of Medical Sciences (IR.Rums.REC.1395.38) based on US NIH Laboratory Animal Usage and Care Rules.

2.2. The experimental groups

In this study, 5 different experimental groups (each group including 8 rats) were examined:

1) Non morphine remedied rats; 2) non morphine-treated rats + 25 mg/kg crocin; 3) morphine remedied rats (10 mg/kg); 4 and 5) morphine-treated rats + 12.5 and 25 mg/kg crocin, respectively.

2.3. Morphine and crocin injection

The rats were treated with morphine sulfate (10 mg/kg) with an interval of 12 h for 21 d, subcutaneously (s.c.). Morphine sulfate (Temad, Tehran, Iran) was dissolved in a volume of 10 mg/1 mL physiological saline before each injection. In the crocin treated groups, the crocin was injected in the form of intraperitoneal injections (i.p.) to 12.5 and 25 mg/kg per day at the beginning of the research to the end of a period for 21 d[18]. At the end of the study period (day 21), the rats were anesthetized (50 mg/kg ketamine and 4 mg/kg Xylasein, i.p. injection) and decapitated using the guillotine. For molecular analysis, the VTA was separated from other areas as a result of coordinates of the Watson-Paksinus Brain Atlas. The blood vessel of rats was accumulated in the flask for separation of serum and analysis of the level of BDNF protein. The blood samples were centrifuged for 15 min with speed of 1 000 rpm to accumulate the blood serum. The collected serum was retained in freezer with temperatures of -20 °C for further measurements[19].

2.4. Measurement of BDNF

The BDNF level in serum was measured by ELISA method and using ZellBio Kit (Germany) and based on the instruction of the manufacturing company.

2.5. Serum glucose, triglyceride and cholesterol level analysis

The serum fasting blood sugar (FBS), cholesterol and triglyceride were examinated using auto-analyzer device (KonE, Finland).

2.6. RNA extraction and complementary DNA (cDNA) synthesis

Total RNA extraction of cell was done on the tissue separated from VTA area using RNA Pars Tous Kit (Iran) according to its protocol. RNA sample was dissolved in diethylpyrocarbonate-treated water and RNA measures were determined by an APEL PD-303UV spectrophotometer (Japan). The fidelity of extracted RNA was examined by electrophoresis 1% agarose and further staining with DNA Green Viewer™ and three bands with the Gel Doc were seen from each RNA sample. cDNA was performed by using a reverse transcriptase kit (Bioneer, Korea). The cDNA was stored at -20 °C or immediately used for quantitative real-time polymerase chain reaction (Real-Time PCR). The cDNA was synthesized by Bio-Rad device produced by America Hack Company. Subsequently, RNA was converted to cDNA by reverse transcriptase enzyme, which was used as a target in the RT-PCR technique. To do so, we used to 10 μL of diethylpyrocarbonate, total RNA, oligo dT, and random hexamer primers. Then, they were incubated for 10 min at 70 °C. After this step, 10 μL of RT-mix was added into micro-tube. The mixture was put at 42 °C for 60 min for cDNA synthesis. Finally, to inactivate RT-enzymes; the mixture was incubated at 95 °C for 5 min[20].

2.7. Real-Time PCR

To perform Real-Timze PCR test, by using a reverse primer and a forward primer specified to particular BDNF and CREB genes as special genes and β -actin gene as housekeeping gene (control), the synthesized cDNAs were determined by the referred genes and using SYBR PCR master mix (Takara) in the device, System Step One™ Real-Time PCR (ABI, USA) and the Ct of BDNF, CREB and β -actin genes in studying group was determined. The thermal conditions of Real-Time PCR included 95 °C for 30 min for primary denaturation, 40 cycles and each cycle including 95 °C for 5 s for the denaturation, and 60 °C for 30 min for annealing and extension. In this research, β -actin (housekeeping gene) was used as a control. The expression level of each gene was located in the 2 ΔΔCt- formula as a result of the level of Ct and the Ct of control gene and the difference in the number of target gene was measured in comparison to control gene (β -actin)[21]. The primers in this study were designed using Beacon designer 7.8 (Biosoft, USA) and were BLAST using the software program in site (http://www.ncbi.nlm.nih.gov tools/primer- blast).

BDNF: forward GTTGCATGAAGGCTGCGCCC BDNF: reverse CTGCCCTGGGCCCATTCACG

CREB: forward CCAAACTAGCAGTGGGCAGT CREB: reverse GAATGGTAGTACCCGGCTGA

β -actin: forward AGGGAAATCGTGCGTGAC

β-actin: reverse CGCTCATTGCCGATAGTG

2.8. Statistical analysis

Data are expressed as mean ± SEM. Statistical analysis was performed using GraphPad Prism version 6.01 for Windows (GraphPad Software, USA). To compare the obtained data from different groups, One-way ANOVA test was used. Moreover, Tukey’s post hoc test was used following ANOVA to test significance among different groups. P<0.05 was considered statistically significant.


  3. Results Top


3.1. Glucose, triglyceride and cholesterol serum level

In this study, glucose, triglyceride and cholesterol level in blood serum were measured in all experimental groups. As shown in [Figure 1], the serum glucose level in rats treated with morphine was enhanced significantly compared to control rats (P<0.001). Treatment with 12.5 and 25 mg/kg of crocin could reduce the glucose level (dose-depended) in rats treated with morphine. This should be mentioned that the reduction was significant compared to the group treated with morphine (P<0.001) [Figure 1]. The data in this study showed that treatment of rats with morphine could lead to a significant increase in serum cholesterol level compared to control group (P<0.01). Moreover, it was discovered that crocin treatment wasn’t able to decrease the serum cholesterol in the group treated with morphine [Figure 2]. The results obtained from this study showed that treatment of rats with morphine could cause a significant increase in serum triglyceride level compared to control group (P<0.01). Significant difference has not been discovered between group treated with morphine + crocin and group treated with morphine [Figure 3].
Figure 1: Serum glucose level in different experimental groups.
Data have been presented as mean ± SEM. n=8 in each group; one-way ANOVA and Tukey post test are used to compare the values obtained from different experimental groups. ###P<0.001, significant difference compared to morphine treated group. ***P<0.001, significant difference compared to control group.


Click here to view
Figure 2: Serum cholesterol level in different experimental groups.
Data have been presented in form of mean ± SEM. In each group, n=8; one-way ANOVA and Tukey post test are used to compare the values obtained from different experimental groups. *P<0.01, significant difference compared to control group.


Click here to view
Figure 3: Serum triglyceride level in different experimental groups.
Data have been presented in form of mean ± SEM. In each group, n=8; one-way ANOVA and Tukey post test are used to compare the values obtained from different experimental groups. **P<0.01, significant difference compared to control group.


Click here to view


3.2. BDNF and CREB gene expression

BDNF and CREB gene expression was measured using Real-Time PCR in VTA tissue in several experimental groups. The data of these experiments showed that treatment of rats with morphine leads to significant decrease in BDNF and CREB gene expression in the VTS area of these rats in comparison to control group (P<0.01 and P<0.001 respectively). This should be mentioned that BDNF and CREB gene expression in the VTA area of rats treated with morphine + 25 mg/kg crocin was significantly higher than that of a group treated just with morphine (P<0.01 and P<0.05 respectively) [Figure 4] and [Figure 5]. No significant difference was observed between the group treated with morphine + 12.5 mg/kg crocin and solely morphine-treated group [Figure 4] and [Figure 5].
Figure 4: BDNF gene expression in brain VTA area in different experimental groups.
Data have been presented in form of mean ± SEM. In each group, n=8; one-way ANOVA and Tukey post test are used to compare the values obtained from different experimental groups. **P<0.01, significant difference compared to control group; ##P<0.01, significant difference compared to morphine-treated group.


Click here to view
Figure 5: CREB gene expression in brain VTA area in different experimental groups.
Data have been presented in form of mean ± SEM. In each group, n=8; one-way ANOVA and Tukey post test are used to compare the values obtained from different experimental groups. ***P<0.001, significant difference compared to control group; #P<0.05, significant difference compared to morphine-treated group.


Click here to view


3.3. BDNF serum level

The BDNF protein level was measured using ELISA method. As illustrated in [Figure 6], the BDNF serum protein level in morphine- treated rats was significantly decreased in comparison to control group (P<0.01). The crocin administration at dose of 25 mg/kg in morphine treated rats could lead to significant enhancement in serum BDNF level in comparison to the group treated with morphine (P<0.01) [Figure 6].
Figure 6: BDNF serum protein level in different experimental groups. Data have been presented in form of mean ± SEM. In each group, n=8; one-way ANOVA and Tukey post test are used to compare the values obtained from different experimental groups. *P<0.01, significant difference compared to control group; #P<0.01, significant difference compared to morphine-treated group.

Click here to view


4. Discussion

In this research, the effect of crocin on BDNF and CREB genes expression as well as BDNF serum level was studied in morphine-treated rats. Regarding to the obtained outcomes, treatment with morphine could lead to significant decrease of BDNF and CREB gene expression in the brain VTA area and decrease of BDNF serum level in comparison to control rats. Furthermore, the data showed that treatment with crocin at dose of 25 mg/kg could cause significant enhancement in BDNF and CREB gene expression in the brain VTA area as well as serum BDNF level in rats treated with morphine. It has been specified that there are a lot of μ-opioid receptor in the brain VTA area and their activation related to the rewarding effects of morphine[22]. In addition, previous researches have demonstrated that the addictive behaviors caused by morphine are depended on the activation of dopaminergic neurons in the brain VTA area. Therefore, reward response produced by activation of VTA-dopaminergic neurons by morphine could be one of the key factors of dependence on addictive substances[23],[24]. BDNF is recognized as a factor for brain growth, neural reconstruction and synapse plasticity[25]. BDNF receptors are plentifully available in the VTA-dopaminergic neurons[26]. BDNF might lead to survival and protection of dopamine neurons in the brain[27],[28]. In this field, it has been revealed that significant decrease of BDNF in the substantia nigra brain of Parkinson patients may lead to degeneration and destruction of these dopaminergic neurons[29]. Different studies have affirmed the effect of BDNF in learning, memory, identification, perception and regulation of various types of feelings. Moreover, BDNF disruption that can involve in many cognitive disorders such as schizophrenia, huntington, autism, depression, addiction and anxiety disorders has been studied[30],[31]. CREB is transcription factor activated in response to signaling routes such as calcium-calmodulin, growth factor and cytokines. Phosphorylation of CREB protein at ser133 by protein kinase A, MAP kinase and extracellular signal-regulated kinase could activate several gene transcription[32]. One of the target genes of CREB is BDNF, which is responsible for regulating their gene expression[33]. Deactivation or decrease of CREB could reduce BDNF gene expression. In addition, the BDNF-TrkB signaling route could lead to activation of CREB through activating extracellular signal-regulated kinase and hence, the two factors could form a positive response loop[34]. The review conducted by Koo et al. on morphine-depended rats showed that, the BDNF gene expression level is significantly reduced in VTA area. Furthermore, they discovered that the activity of CREB decreases in morphine-depended rats[35]. Yang et al. showed that chronic exposure of rat to morphine could decrease CREB phosphorylation level in the hippocampus area[36]. Zhou et al. demonstrated that morphine injection to rats can decrease CREB level in NAc[37]. According to the outcomes of present research, chronic morphine treatment could cause significant reduction of CREB gene expression in the brain VTA area of male Wistar rats. Zhang et al. compared heroin-dependent people (an opioid derivative) with normal people and found that in heroin-dependent individuals, serum BDNF level was decreased compared to controls (P<0.01)[38]. The research conducted by Angelucci et al. demonstrated that in heroin-dependent individuals, serum BDNF level is decreased and due to the function of the proteins, and decrease of its level in these individuals could raise the risk of psychosis disease[39]. The research performed by

Ghodrati et al. on rats under treatment with morphine demonstrated enhanced level of anxiety, memory dysfunction and reduced BDNF level in hippocampus[40]. Nunes et al. demonstrated that exposuring rat infants to morphine could decrease the BDNF level in their cerebral cortex[41]. According to Lee et al., BDNF gene expression is reduced in hippocampus of morphine-depended rats[42]. Research performed by Chen et al. also showed that in rats exposed to chronic use of morphine, serum level and the BDNF protein expression were decreased in NAc area[43]. Koo et al. demonstrated that in morphine-dependent individuals, decrease of expression and signaling of TrkB-BDNF could cause enhanced bonus process induced by morphine consumption. This seems that this function is caused by controlling GABA receptor in the NAc area[44]. Moreover, the present research discovered that morphine-dependence could decrease BDNF gene expression in VTA area and its serum level in male rats significantly. Decreased serum and cerebral level of BDNF may demonstrate special amount of neural degeneration caused by long-term drug abuse in the body. Regarding to these results, using medicines may have an incremental impact on neurotrophins and could improve the effects of drugs on neural cells, which may be useful in the treatment of addiction to opioids. Vahdati et al. has researched the effect of saffron crocin on BDNF and CREB gene expression and found that crocin could enhance the levels of the two types of proteins in the hippocampus area of rats[18]. Ghasemi et al. studied the antidepression effects of saffron (main herbal source of crocin) on rats and discovered that saffron could raise the levels of BDNF and CREB in hippocampus significantly[45]. In the study of Liu et al., chronic morphine administration induced upregulation of BDNF. Inhibiting BDNF effectively delayed the generation of MIH and tolerance. The upregulation of BDNF induced by morphine was significantly suppressed by inhibiting Shh signaling. Inhibiting BDNF significantly suppressed smoothened agonist-induced hyperalgesia[46]. In the study of Razavi et al., in long term crocin treatment, a slight increase was observed in protein level of P-CREB, but it was not significant. It is concluded that antidepressant activity of crocin might be partially mediated by CREB[47]. In the present study, we showed that crocin could significantly increase BDNF and CREB gene expression in the brain VTA of morphine-treated rats. Additionally, administration of crocin could elevate the serum BDNF level in morphine-treated animals significantly.

Altogether the results obtained from this study showed that chronic treatment of rats exposured to morphine could decrease expression of BDNF and CREB genes in the VTA area as well as serum BDNF level. Furthermore, the results obtained from this study showed that crocin administration with morphine could increase BDNF and CREB gene expression in the VTA area as well as serum BDNF level. The reduction of BDNF protein expression could lead to underlying difficulties and may lead to other species in the neural system. Hence, crocin as a complementary factor could be considered as remedying of morphine administration, side effects

in opioid depended patients or the people treated with morphine for chronic period.

Conflict of interest statement

The authors of present study declared there is no conflict of interest.

Acknowledgments

This project was financially supported by a grant (20/341/1395) from the Rafsanjan University of Medical Sciences.



 
  References Top

1.
Bao Y, Gao Y, Yang L, Kong X, Yu J, Hou W, et al. The mechanism of muopioid receptor (MOR)-TRPV1 crosstalk in TRPV1 activation involves morphine anti-nociception, tolerance and dependence. Channels (Austin) 2015; 9(5): 235-243.  Back to cited text no. 1
    
2.
Evans CS, He Z, Bai H, Lou X, Jeggle P, Sutton RB, et al. Functional analysis of the interface between the tandem C2 domains of synaptotagmin-1. Mol Biol Cell 2016; 27(6): 979-989.  Back to cited text no. 2
    
3.
Zhang Y, Loh HH, Law PY. Effect of opioid on adult hippocampal neurogenesis. Sci World J 2016; 2016: 2601264.  Back to cited text no. 3
    
4.
Joffe ME, Grueter CA, Grueter BA. Biological substrates of addiction. Wiley Interdiscip Rev Cogn Sci 2014; 5(2): 151-171.  Back to cited text no. 4
    
5.
Volkow ND, McLellan AT. Mitigation strategies for opioid abuse. New Engl J Med 2016; 375(1): 96.  Back to cited text no. 5
    
6.
Berke JD, Hyman SE. Addiction, dopamine, and the molecular mechanisms of memory. Neuron 2000; 25(3): 515-532.  Back to cited text no. 6
    
7.
Dincheva I, Lynch NB, Lee FS. The role of BDNF in the development of fear learning. Depress Anxiety 2016; 33(10): 907-916.  Back to cited text no. 7
    
8.
Cattaneo A, Cattane N, Begni V, Pariante CM, Riva MA. The human BDNF gene: Peripheral gene expression and protein levels as biomarkers for psychiatric disorders. Transl Psychiatry 2016; 6(11): e958.  Back to cited text no. 8
    
9.
Han B, Zhang XY, Wang DY, Ren WW, Gu YY, Zhu L, et al. Serum brain-derived neurotrophic factor levels and psychotic symptoms in heroin dependence. Compr Psychiatry 2015; 62: 80-85.  Back to cited text no. 9
    
10.
Koo JW, Mazei-Robison MS, LaPlant Q, Egervari G, Braunscheidel KM, Adank DN, et al. Epigenetic basis of opiate suppression of Bdnf gene expression in the ventral tegmental area. Nat Neurosci 2015; 18(3): 415-422.  Back to cited text no. 10
    
11.
Hansen RT 3rd, Zhang HT. Senescent-induced dysregulation of cAMP/ CREB signaling and correlations with cognitive decline. Brain Res 2013; 1516: 93-109.  Back to cited text no. 11
    
12.
Ortega-Martínez S. A new perspective on the role of the CREB family of transcription factors in memory consolidation via adult hippocampal neurogenesis. Front Mol Neurosci 2015; 8(46): 46.  Back to cited text no. 12
    
13.
Wang H, Peng RY. Basic roles of key molecules connected with NMDAR signaling pathway on regulating learning and memory and synaptic plasticity. Mil Med Res 2016; 3(1): 26.  Back to cited text no. 13
    
14.
Ochiai T, Shimeno H, Mishima K, Iwasaki K, Fujiwara M, Tanaka H, et al. Protective effects of carotenoids from saffron on neuronal injury in vitro and in vivo. Biochim Biophys Acta 2007; 1770(4): 578-584.  Back to cited text no. 14
    
15.
Abe K, Saito H. Effects of saffron extract and its constituent crocin on learning behaviour and long-term potentiation. Phytother Res 2000; 14(3): 149-152.  Back to cited text no. 15
    
16.
Papandreou MA, Kanakis CD, Polissiou MG, Efthimiopoulos S, Cordopatis P, Margarity M, et al. Inhibitory activity on amyloid-beta aggregation and antioxidant properties of Crocus sativus stigmas extract and its crocin constituents. J Agric Food Chem 2006; 54(23): 8762-8768.  Back to cited text no. 16
    
17.
Pitsikas N, Zisopoulou S, Tarantilis PA, Kanakis CD, Polissiou MG, Sakellaridis N. Effects of the active constituents of Crocus sativus L., crocins on recognition and spatial rats’ memory. Behav Brain Res 2007; 183(2): 141-146.  Back to cited text no. 17
    
18.
Vahdati Hassani F, Naseri V, Razavi BM, Mehri S, Abnous K, Hosseinzadeh H. Antidepressant effects of crocin and its effects on transcript and protein levels of CREB, BDNF, and VGF in rat hippocampus. DARU J Pharm Sci 2014; 22(1): 16.  Back to cited text no. 18
    
19.
Elfving B, Plougmann PH, Wegener G. Detection of brain-derived neurotrophic factor (BDNF) in rat blood and brain preparations using ELISA: Pitfalls and solutions. J Neurosci Methods 2010; 187(1): 73-77.  Back to cited text no. 19
    
20.
Karimabad MN, Mahmoodi M, Jafarzadeh A, Darehkordi A, Hajizadeh MR, Khorramdelazad H, et al. Evaluating of OCT-4 and NANOG was differentially regulated by a new derivative indole in leukemia cell line. Immunol Lett 2017; 190: 7-14.  Back to cited text no. 20
    
21.
Karimabad MN, Mahmoodi M, Jafarzadeh A, Darehkordi A, Hajizadeh MR, Khorramdelazad H, et al. The novel Indole-3-formaldehyde (2-AITFEI-3-F) is involved in processes of apoptosis induction? Life Sci 2017; 181: 31-44.  Back to cited text no. 21
    
22.
Kim J, Ham S, Hong H, Moon C, Im HI. Brain reward circuits in morphine addiction. Mol Cells 2016; 39(9): 645-653.  Back to cited text no. 22
    
23.
Luscher C, Malenka RC. Drug-evoked synaptic plasticity in addiction: From molecular changes to circuit remodeling. Neuron 2011; 69(4): 650-663.  Back to cited text no. 23
    
24.
Georges F, Le Moine C, Aston-Jones G. No effect of morphine on ventral tegmental dopamine neurons during withdrawal. J Neurosci 2006; 26(21): 5720-5726.  Back to cited text no. 24
    
25.
Lee BH, Park TY, Lin E, Li H, Yang CH, Choi KH. Altered acoustic startle reflex, prepulse inhibition, and peripheral brain-derived neurotrophic factor in morphine self-administered rats. Int J Neuropsychopharmacol 2017; 20(5): 383-391.  Back to cited text no. 25
    
26.
Chen KW, Chen L. Epigenetic regulation of BDNF gene during development and diseases. Int J Mol Sci 2017; 18(3): 571.  Back to cited text no. 26
    
27.
Hyman C, Hofer M, Barde YA, Juhasz M, Yancopoulos GD, Squinto SP, et al. BDNF is a neurotrophic factor for dopaminergic neurons of the substantia nigra. Nature 1991; 350(6315): 230-232.  Back to cited text no. 27
    
28.
Ding YX, Xia Y, Jiao XY, Duan L, Yu J, Wang X, et al. The TrkB-positive dopaminergic neurons are less sensitive to MPTP insult in the substantia nigra of adult C57/BL mice. Neurochem Res 2011; 36(10): 1759-1766.  Back to cited text no. 28
    
29.
Hernandez-Chan NG, Bannon MJ, Orozco-Barrios CE, Escobedo L, Zamudio S, De la Cruz F, et al. Neurotensin-polyplex-mediated brain-derived neurotrophic factor gene delivery into nigral dopamine neurons prevents nigrostriatal degeneration in a rat model of early Parkinson’s disease. J Biomed Sci 2015; 22(1): 59.  Back to cited text no. 29
    
30.
Sasi M, Vignoli B, Canossa M, Blum R. Neurobiology of local and intercellular BDNF signaling. Pflugers Arch 2017; 469(5-6): 593-610.  Back to cited text no. 30
    
31.
Bathina S, Das UN. Brain-derived neurotrophic factor and its clinical implications. Arch Med Sci 2015; 11(6): 1164-1178.  Back to cited text no. 31
    
32.
Manning CE, Williams ES, Robison AJ. Reward network immediate early gene expression in mood disorders. Front Behav Neurosci 2017; 11: 77.  Back to cited text no. 32
    
33.
Nair A, Vaidya VA. Cyclic AMP response element binding protein and brain-derived neurotrophic factor: Molecules that modulate our mood? J Biosci 2006; 31(3): 423-424.  Back to cited text no. 33
    
34.
Wang C, Guo J, Guo R. Effect of XingPiJieYu decoction on spatial learning and memory and cAMP-PKA-CREB-BDNF pathway in rat model of depression through chronic unpredictable stress. BMC Complement Altern Med 2017; 17: 73.  Back to cited text no. 34
    
35.
Koo JW, Mazei-Robison MS, Chaudhury D, Juarez B, LaPlant Q, Ferguson D, et al. BDNF is a negative modulator of morphine action. Science 2012; 338(6103): 124-128.  Back to cited text no. 35
    
36.
Yang HY, Pu XP. Chronic morphine administration induces overexpression of aldolase C with reduction of CREB phosphorylation in the mouse hippocampus. Eur J Pharmacol 2009; 609(1-3): 51-57.  Back to cited text no. 36
    
37.
Zhou L, Zhu Y. Changes of CREB in rat hippocampus, prefrontal cortex and nucleus accumbens during three phases of morphine induced conditioned place preference in rats. Zhejiang Univ Sci B 2006; 7(2): 107-113.  Back to cited text no. 37
    
38.
Zhang K, Jiang H, Zhang Q, Du J, Wang Y, Zhao M. Brain-derived neurotrophic factor serum levels in heroin-dependent patients after 26 weeks of withdrawal. Compr Psychiatry 2016; 65: 150-155.  Back to cited text no. 38
    
39.
Angelucci F, Ricci V, Pomponi M, Conte G, Mathe AA, Attilio Tonali P, et al. Chronic heroin and cocaine abuse is associated with decreased serum concentrations of the nerve growth factor and brain-derived neurotrophic factor. J Psychopharmacol 2007; 21(8): 820-825.  Back to cited text no. 39
    
40.
Ghodrati-Jaldbakhan S, Ahmadalipour A, Rashidy-Pour A, Vafaei AA, Miladi-Gorji H, Alizadeh M. Low- and high-intensity treadmill exercise attenuates chronic morphine-induced anxiogenesis and memory impairment but not reductions in hippocampal BDNF in female rats. Brain Res 2017; 1663: 20-28.  Back to cited text no. 40
    
41.
Nunes EA, Medeiros LF, de Freitas JS, Macedo IC, Kuo J, de Souza A, et al. Morphine exposure during early life alters thermal and mechanical thresholds in rats. Int J Dev Neurosci 2017; 60: 78-85.  Back to cited text no. 41
    
42.
Lee B, Sur B, Yeom M, Shim I, Lee H, Hahm DH. Effect of berberine on depression- and anxiety-like behaviors and activation of the noradrenergic system induced by development of morphine dependence in rats. Korean J Physiol Pharmacol 2012; 16(6): 379-386.  Back to cited text no. 42
    
43.
Chen SL, Tao PL, Chu CH, Chen SH, Wu HE, Tseng LF, et al. Low-dose memantine attenuated morphine addictive behavior through its anti-inflammation and neurotrophic effects in rats. J Neuroimmune Pharmacol 2012; 7(2): 444-453.  Back to cited text no. 43
    
44.
Koo JW, Lobo MK, Chaudhury D, Labonté B, Friedman A, Heller E, et al. Loss of BDNF signaling in D1R-expressing NAc neurons enhances morphine reward by reducing GABA inhibition. Neuropsychopharmacology 2014; 39(11): 2646-2653.  Back to cited text no. 44
    
45.
Ghasemi T, Abnous K, Vahdati F, Mehri S, Razavi BM, Hosseinzadeh H. Antidepressant effect of Crocus sativus aqueous extract and its effect on CREB, BDNF, and VGF transcript and protein levels in rat hippocampus. Drug Res (Stuttg) 2015; 65(7): 337-343.  Back to cited text no. 45
    
46.
Liu S, Yao JL, Wan XX, Song ZJ, Miao S, Zhao Y, et al. Sonic hedgehog signaling in spinal cord contributes to morphine-induced hyperalgesia and tolerance through upregulating brain-derived neurotrophic factor expression. J Pain Res 2018; 11: 649-659.  Back to cited text no. 46
    
47.
Razavi BM, Sadeghi M, Abnous K, Vahdati Hasani F, Hosseinzadeh H. Study of the role of CREB, BDNF, and VGF neuropeptide in long term antidepressant activity of crocin in the rat cerebellum. Iran J Pharm Res 2017; 16(4): 1452-1462.  Back to cited text no. 47
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5], [Figure 6]



 

Top
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

  2. Materials and...
  In this article
Abstract
1. Introduction
3. Results
References
Article Figures

 Article Access Statistics
    Viewed294    
    Printed25    
    Emailed0    
    PDF Downloaded89    
    Comments [Add]    

Recommend this journal